-
PurposeCRISPR/Cas9-based dual-fluorescent DSB repair reporter
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 149355 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepCW-Cas9
-
Vector typeMammalian Expression, Lentiviral
-
Selectable markersBlasticidin
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberUnknown
Gene/Insert 1
-
Gene/Insert nameCDDR Reporter
-
Alt nameCRISPR/Cas9-based Dual-fluorescent DSB Repair Reporter
-
Insert Size (bp)1487
- Promoter EF-1a
Cloning Information for Gene/Insert 1
- Cloning method Gibson Cloning
- 5′ sequencing primer gatgtcgtgtactggctccg (Common Sequencing Primers)
Gene/Insert 2
-
Gene/Insert nameBlasticidin resistance
-
Alt nameBSD
-
Insert Size (bp)396
- Promoter hPGK
Cloning Information for Gene/Insert 2
- Cloning method Restriction Enzyme
- 5′ cloning site BamHI (destroyed during cloning)
- 3′ cloning site XmaI (not destroyed)
- 5′ sequencing primer cactagtaccctcgcagacg (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
lenti-CDDR was a gift from Tarek Abbas (Addgene plasmid # 149355 ; http://n2t.net/addgene:149355 ; RRID:Addgene_149355) -
For your References section:
A robust CRISPR-Cas9-based fluorescent reporter assay for the detection and quantification of DNA double-strand break repair. Eki R, She J, Parlak M, Benamar M, Du KP, Kumar P, Abbas T. Nucleic Acids Res. 2020 Oct 17. pii: 5929239. doi: 10.1093/nar/gkaa897. 10.1093/nar/gkaa897 PubMed 33068408