Skip to main content

pSH1/M-Fv-Casp3-E
(Plasmid #15271)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 15271 Standard format: Plasmid sent in bacteria as agar stab 1 $94
DNA 15271-D50 50 μg of DNA in Tris buffer $495
DNA 15271-D100 100 μg of DNA in Tris buffer $585

Backbone

  • Vector backbone
    pSH1
  • Backbone manufacturer
    GR Crabtree lab
  • Backbone size w/o insert (bp) 3500
  • Vector type
    Mammalian Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    FKBP12(V36)-Caspase3
  • Alt name
    yama, iCaspase-3
  • Species
    H. sapiens (human)
  • Insert Size (bp)
    1240
  • Mutation
    FKBP12(V36) F36->V
  • Entrez Gene
    CASP3 (a.k.a. CPP32, CPP32B, SCA-1)
  • Tags / Fusion Proteins
    • HA epitope (C terminal on insert)
    • Myristoylation-targeting domain c-Src (14aa) (N terminal on insert)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site NotI, SacII (not destroyed)
  • 3′ cloning site EcoRI, BamHI (not destroyed)
  • 5′ sequencing primer gaggtgttacttctgctctaaaagc
  • 3′ sequencing primer cactgcattctagttgtggtttg
  • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.

Purpose

Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.

Delivery

  • Amount 50 μg
  • Concentration 1 μg/μL
  • Pricing $495 USD
  • Storage 4 ℃ (short-term) or -20 ℃ (long-term)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Quality Control

Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.

Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.

Purpose

Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.

Delivery

  • Amount 100 μg
  • Concentration 1 μg/μL
  • Pricing $585 USD
  • Storage 4 ℃ (short-term) or -20 ℃ (long-term)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Quality Control

Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.

Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pSH1/M-Fv-Casp3-E was a gift from David Spencer (Addgene plasmid # 15271 ; http://n2t.net/addgene:15271 ; RRID:Addgene_15271)
  • For your References section:

    Improved artificial death switches based on caspases and FADD. Fan L, Freeman KW, Khan T, Pham E, Spencer DM. Hum Gene Ther. 1999 Sep 20. 10(14):2273-85. 10.1089/10430349950016924 PubMed 10515447