dCas9-DNMT3a-DNMT3l-3xFLAG-tagBFP
(Plasmid
#154139)
-
PurposeExpresses the dCas9-DNMT3a-DNMT3l-3xFLAG-tagBFP fusion protein for targeted DNA methylation.
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 154139 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 |
Backbone
-
Vector backboneAmpR-Ori
- Backbone size w/o insert (bp) 5254
- Total vector size (bp) 12028
-
Vector typeMammalian Expression
-
Selectable markersNeomycin (select with G418)
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert namedCas9, DNMT3a (catalytic domain), DNMT3l (C-terminal part), tagBFP
-
SpeciesH. sapiens (human); Streptococcus pyogenes
-
Insert Size (bp)6774
-
GenBank IDNM_007872.4 NM_019448.4
- Promoter CMV
-
Tags
/ Fusion Proteins
- 3x FLAG
- tagBFP (C terminal on insert)
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer AGCTCGTTTAGTGAACCGTCAGATC
- 3′ sequencing primer TTGTCTCCTTCCGTGTTTCA (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
dCas9-DNMT3a-DNMT3l-3xFLAG-tagBFP was a gift from Albert Jeltsch (Addgene plasmid # 154139 ; http://n2t.net/addgene:154139 ; RRID:Addgene_154139) -
For your References section:
Engineering of Effector Domains for Targeted DNA Methylation with Reduced Off-Target Effects. Hofacker D, Broche J, Laistner L, Adam S, Bashtrykov P, Jeltsch A. Int J Mol Sci. 2020 Jan 13;21(2). pii: ijms21020502. doi: 10.3390/ijms21020502. 10.3390/ijms21020502 PubMed 31941101