Skip to main content

dCas9-DNMT3a-DNMT3l-3xFLAG-tagBFP
(Plasmid #154139)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 154139 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    AmpR-Ori
  • Backbone size w/o insert (bp) 5254
  • Total vector size (bp) 12028
  • Vector type
    Mammalian Expression
  • Selectable markers
    Neomycin (select with G418)

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    dCas9, DNMT3a (catalytic domain), DNMT3l (C-terminal part), tagBFP
  • Species
    H. sapiens (human); Streptococcus pyogenes
  • Insert Size (bp)
    6774
  • GenBank ID
    NM_007872.4 NM_019448.4
  • Promoter CMV
  • Tags / Fusion Proteins
    • 3x FLAG
    • tagBFP (C terminal on insert)

Cloning Information

  • Cloning method Gibson Cloning
  • 5′ sequencing primer AGCTCGTTTAGTGAACCGTCAGATC
  • 3′ sequencing primer TTGTCTCCTTCCGTGTTTCA
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

Trademarks:

  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    dCas9-DNMT3a-DNMT3l-3xFLAG-tagBFP was a gift from Albert Jeltsch (Addgene plasmid # 154139 ; http://n2t.net/addgene:154139 ; RRID:Addgene_154139)
  • For your References section:

    Engineering of Effector Domains for Targeted DNA Methylation with Reduced Off-Target Effects. Hofacker D, Broche J, Laistner L, Adam S, Bashtrykov P, Jeltsch A. Int J Mol Sci. 2020 Jan 13;21(2). pii: ijms21020502. doi: 10.3390/ijms21020502. 10.3390/ijms21020502 PubMed 31941101