Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected] Learn more

pMTTH+eGFP-bromo5(N140A)
(Plasmid #157806)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 157806 Standard format: Plasmid sent in bacteria as agar stab 1 $75

This material is available to academics and nonprofits only.

Backbone

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    Low Copy

Gene/Insert

  • Gene/Insert name
    eGFP-bromo5(N140A)
  • Species
    H. sapiens (human)
  • Insert Size (bp)
    2901
  • Mutation
    N140A
  • Promoter pTAC
  • Tags / Fusion Proteins
    • MBP (N terminal on insert)
    • His6 (C terminal on backbone)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site NdeI (not destroyed)
  • 3′ cloning site BamHI (not destroyed)
  • 5′ sequencing primer GGTCGTCAGACTGTCGATGAAGCC
  • 3′ sequencing primer TGTCCTACTCAGGAGAGCGTTCAC
  • (Common Sequencing Primers)

Resource Information

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pMTTH+eGFP-bromo5(N140A) was a gift from Michael Rosen (Addgene plasmid # 157806 ; http://n2t.net/addgene:157806 ; RRID:Addgene_157806)
  • For your References section:

    Organization of Chromatin by Intrinsic and Regulated Phase Separation. Gibson BA, Doolittle LK, Schneider MWG, Jensen LE, Gamarra N, Henry L, Gerlich DW, Redding S, Rosen MK. Cell. 2019 Oct 3;179(2):470-484.e21. doi: 10.1016/j.cell.2019.08.037. Epub 2019 Sep 19. 10.1016/j.cell.2019.08.037 PubMed 31543265