-
PurposeEncodes a polyspecific aminoacyl-tRNA synthetase fused to a modified releasing factor and four copies of amber suppression tRNAs for unnatural amino acid incorporation in mammalian cells
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 157925 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepMAH
- Backbone size w/o insert (bp) 7583
- Total vector size (bp) 10256
-
Vector typeMammalian Expression
-
Selectable markersHygromycin
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert namePOLY-eRF1(E55D), Polyspecific aminoacyl-tRNA Synthetase fused to a modified releasing factor through 2A peptide
-
Insert Size (bp)2673
- Promoter CMV
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer ACA CAT ACG ATT TAG GTG ACA CTA TAG AAT
- 3′ sequencing primer ATGAAAGCCATACGGGAAGCAATAGC (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
This plasmid can be used in mammalian cells to genetically encode an array of para-substituted phenylalanine analogs, including p-boronophenylalaine (pBoF), p-azidophenylalanine (pAzF), p-acetylphenylalanine (pAcF), p-iodophenylalanine (pIoF), p-bromophenylalanine (pBrF), p-cyanophenylalanine (pCNF), p-nitrophenylalanine (pNO2F), p-benzoylphenylalanine (pBzF), 4,4′-biphenylalanine (BIF), O-methyl-tyrosine (OMeY), O-propargyl-tyrosine (OPrY), and O-allyl-tyrosine.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pMAH-POLY-eRF1(E55D) was a gift from Huiwang Ai (Addgene plasmid # 157925 ; http://n2t.net/addgene:157925 ; RRID:Addgene_157925) -
For your References section:
A high-performance genetically encoded fluorescent biosensor for imaging physiological peroxynitrite. Chen Z, Zhang S, Li X, Ai HW. Cell Chem Biol. 2021 Jan 27. pii: S2451-9456(21)00013-1. doi: 10.1016/j.chembiol.2021.01.013. 10.1016/j.chembiol.2021.01.013 PubMed 33581056