pBS-GMR-eya(shRNA)
(Plasmid
#157991)
-
Purpose(Empty Backbone) pBSII-KS(-)-based vector backbone containing a dominant eye marker for constructing Drosophila CRISPR HDR templates. Marker allows counter selection against vector integration events.
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 157991 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepBSII-KS(-)
- Backbone size (bp) 2961
-
Modifications to backbonea GMR-eya(shRNA) marker has been created and inserted into pBS to allow counter selection of vector integration events during CRISPR editing
-
Vector typeCRISPR
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Cloning Information
- 5′ sequencing primer ggcggccgctctagaactag
- 3′ sequencing primer actgggctcgaggcgatc
- (Common Sequencing Primers)
Resource Information
-
Articles Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pBS-GMR-eya(shRNA) was a gift from Greg Beitel (Addgene plasmid # 157991 ; http://n2t.net/addgene:157991 ; RRID:Addgene_157991) -
For your References section:
A Pipeline for Precise and Efficient Genome Editing by sgRNA-Cas9 RNPs in Drosophila. Nyberg KG, Nguyen JQ, Kwon YJ, Blythe S, Beitel GJ, Carthew RW. Fly (Austin). 2020 Oct 5. doi: 10.1080/19336934.2020.1832416. 10.1080/19336934.2020.1832416 PubMed 33016195