Skip to main content

pDOC-K-glmS
(Plasmid #158058)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 158058 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pDOC-K
  • Backbone size w/o insert (bp) 7233
  • Total vector size (bp) 8099
  • Vector type
    Synthetic Biology
  • Selectable markers
    Kanamycin

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert 1

  • Gene/Insert name
    glmS homologous region 1
  • Alt name
    HR1
  • Species
    Salmonella enterica Ser. Typhimurium
  • Insert Size (bp)
    430

Cloning Information for Gene/Insert 1

  • Cloning method Restriction Enzyme
  • 5′ cloning site EcoRi (not destroyed)
  • 3′ cloning site KpnI (not destroyed)
  • 5′ sequencing primer CATGATTACGCCAAGCTCTAG
  • 3′ sequencing primer ACCGGTCCTAGGTACCCGGC
  • (Common Sequencing Primers)

Gene/Insert 2

  • Gene/Insert name
    glmS homologous region 2 + MCS3
  • Alt name
    HR2
  • Species
    Salmonella enterica Ser. Typhimurium

Cloning Information for Gene/Insert 2

  • Cloning method Restriction Enzyme
  • 5′ cloning site XhoI (unknown if destroyed)
  • 3′ cloning site NheI (unknown if destroyed)
  • 5′ sequencing primer AAGCTTTCGACAGACGG
  • 3′ sequencing primer GGGTTTTCCCAGTCACGACGT
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pDOC-K-glmS was a gift from Mark Webber (Addgene plasmid # 158058 ; http://n2t.net/addgene:158058 ; RRID:Addgene_158058)
  • For your References section:

    Donor plasmids for phenotypically neutral chromosomal gene insertions in Enterobacteriaceae. Holden ER, Wickham GJ, Webber MA, Thomson NM, Trampari E. Microbiology (Reading). 2020 Nov 23. doi: 10.1099/mic.0.000994. 10.1099/mic.0.000994 PubMed 33226934