Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected] Learn more

p663-UBC-V5-GSK3B_IDG-K
(Plasmid #158166)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 158166 Standard format: Plasmid sent in bacteria as agar stab 1 $75

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    pDest663
  • Backbone manufacturer
    PEL
  • Backbone size w/o insert (bp) 9019
  • Vector type
    Mammalian Expression, Lentiviral ; Gateway Destination
  • Selectable markers
    Puromycin

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin
  • Growth Temperature
    30°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    Low Copy

Gene/Insert

  • Gene/Insert name
    V5-GSK3B
  • Alt name
    GSK3B
  • Species
    H. sapiens (human)
  • Entrez Gene
    GSK3B
  • Promoter Ubiquitin
  • Tag / Fusion Protein
    • V5 (N terminal on insert)

Cloning Information

  • Cloning method Gateway Cloning
  • 5′ sequencing primer GCCCGAAGGAATAGAAGAAGAA
  • 3′ sequencing primer CATAGCGTAAAAGGAGCAACA
  • (Common Sequencing Primers)

Resource Information

Depositor Comments

These plasmids were generated as part of the Illuminating the Druggable Genome (IDG) program sponsored by the NIH Common Fund. The goal of this program is to identify, gather, and distribute information and resources for proteins that currently are not well-studied yet belong to commonly drug-targeted protein families: protein kinases, non-olfactory G-protein coupled receptors (GPCRs), and ion channels. The IDG program is designed to develop fundamental research tools for understudied proteins, elucidate their function, and disseminate the IDG-related resources and data to the greater scientific community. These lentiviral gateway destination plasmids were generated, as part of the Kinase-Data and Resource Generating Center (DRGC), using the single fragment or multisite gateway cloning technology. They were used for generating proteomics-based protein-interaction and protein-proximity networks that can be accessed through the kinase-DRGC website https://darkkinome.org/. Each plasmid has either an N- or C-terminal fusion protein (Flag/ V5/V5-miniTurbo/V5-TurboID/miniTurbo-V5/TurboID-V5) tagged understudied kinase driven under either a CMV or Ubiquitin (UBC) promoter. All inserts in the pENTR plasmids used to generate the deposited destination plasmids were end-sequenced and insert size validated prior to multi-site gateway cloning. The combined insert size of the single fragment or three fragment destination plasmids were confirmed by restriction digestion (BsrGI, and EcoRV for pDest667; BsrGI, EcoRV, and BstZ17I for pDest663; and BsrGI for pHAGE) and all plasmids were partially sequenced to ensure in-frame ORFs and fusion tags.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    p663-UBC-V5-GSK3B_IDG-K was a gift from Ben Major (Addgene plasmid # 158166 ; http://n2t.net/addgene:158166 ; RRID:Addgene_158166)