Skip to main content
Addgene

TagRFP-T_A1aY1
(Plasmid #158751)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 158751 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pTRIP-CAG vector
  • Backbone manufacturer
    Original pTRIP vector from Nicolas Manel
  • Backbone size w/o insert (bp) 11628
  • Total vector size (bp) 11820
  • Modifications to backbone
    pTRIP-CAG vector cloned with TagRFP-T_A1aY1 in between NheI and BamHI restriction sites.
  • Vector type
    Mammalian Expression, Lentiviral

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    30°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    TagRFP-T_A1aY1
  • Alt name
    Red tyrosination sensor
  • Alt name
    Red A1aY1 sensor
  • Insert Size (bp)
    192
  • Promoter CAG (CMV enhancer and chicken beta actin promoter)
  • Tag / Fusion Protein
    • TagRFP-T (N terminal on insert)

Cloning Information

  • Cloning method Gibson Cloning
  • 5′ sequencing primer GAGCCTCTGCTAACCATGTTC
  • 3′ sequencing primer CACAATCAGCATTGGTAGCTGC
  • (Common Sequencing Primers)

Resource Information

  • A portion of this plasmid was derived from a plasmid made by
    Obtained the pTRIP-CAG plasmid from Dr Carsten Janke's lab with permission obtained from Dr Nicolas Manel at Institut Curie, Paris Cedex, France.
  • Articles Citing this Plasmid

Terms and Licenses

Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    TagRFP-T_A1aY1 was a gift from Minhajuddin Sirajuddin (Addgene plasmid # 158751 ; http://n2t.net/addgene:158751 ; RRID:Addgene_158751)
  • For your References section:

    Genetically encoded live-cell sensor for tyrosinated microtubules. Kesarwani S, Lama P, Chandra A, Reddy PP, Jijumon AS, Bodakuntla S, Rao BM, Janke C, Das R, Sirajuddin M. J Cell Biol. 2020 Oct 5;219(10). pii: 152071. doi: 10.1083/jcb.201912107. 10.1083/jcb.201912107 PubMed 32886100