-
PurposeExpresses active Cas9 fused with EGFP for fluorescence microscopy
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 159126 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepMSCVpuro
- Total vector size (bp) 11222
-
Vector typeMammalian Expression, Retroviral, CRISPR
-
Selectable markersPuromycin
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameCas9 fused to EGFP
-
SpeciesH. sapiens (human)
-
Insert Size (bp)4926
- Promoter MSCV LTR promoter
-
Tag
/ Fusion Protein
- EGFP (C terminal on insert)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site BglII (destroyed during cloning)
- 3′ cloning site EcoRI (not destroyed)
- 5′ sequencing primer cccttgaacctcctcgttcgacc
- 3′ sequencing primer cagcggggctgctaaagcgcatgc
- (Common Sequencing Primers)
Resource Information
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Please note that the the M13R primer region is missing compared to the original depositor's sequence.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pMSCVpuro-Cas9-EGFP was a gift from Taekjip Ha (Addgene plasmid # 159126 ; http://n2t.net/addgene:159126 ; RRID:Addgene_159126) -
For your References section:
Very fast CRISPR on demand. Liu Y, Zou RS, He S, Nihongaki Y, Li X, Razavi S, Wu B, Ha T. Science. 2020 Jun 12;368(6496):1265-1269. doi: 10.1126/science.aay8204. 10.1126/science.aay8204 PubMed 32527834