pICE-EGFP-FLAG-PSMD2
(Plasmid
#161917)
-
PurposeExpresses human PSMD2 with a N-terminal GFP-FLAG tag. Confers Puromycin resistance. Inducible in T-REx cells.
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 161917 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 |
Backbone
-
Vector backbonepICE-EGFP-FLAG+(Ku70siR-WT)
-
Backbone manufacturerAddgene #46961
- Backbone size w/o insert (bp) 5743
- Total vector size (bp) 8470
-
Modifications to backboneReplaced Ku70 by PSMD2
-
Vector typeMammalian Expression
-
Selectable markersPuromycin
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert name26S proteasome non-ATPase regulatory subunit 2
-
SpeciesH. sapiens (human)
-
Insert Size (bp)2727
-
Entrez GenePSMD2 (a.k.a. P97, RPN1, S2, TRAP2)
- Promoter CMV
-
Tag
/ Fusion Protein
- GFP-FLAG (N terminal on insert)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site XhoI (not destroyed)
- 3′ cloning site NotI (not destroyed)
- 5′ sequencing primer SEQ-GFPC-F (CATGGTCCTGCTGGAGTTCGTG)
- 3′ sequencing primer SEQ-BGH-R (TAGAAGGCACAGTCGAGG) (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pICE-EGFP-FLAG-PSMD2 was a gift from Sébastien Britton (Addgene plasmid # 161917 ; http://n2t.net/addgene:161917 ; RRID:Addgene_161917) -
For your References section:
SDR enzymes oxidize specific lipidic alkynylcarbinols into cytotoxic protein-reactive species. Demange P, Joly E, Marcoux J, Zanon PRA, Listunov D, Rulliere P, Barthes C, Noirot C, Izquierdo JB, Rozie A, Pradines K, Hee R, de Brito MV, Marcellin M, Serre RF, Bouchez O, Burlet-Schiltz O, Oliveira MCF, Ballereau S, Bernardes-Genisson V, Maraval V, Calsou P, Hacker SM, Genisson Y, Chauvin R, Britton S. Elife. 2022 May 10;11. pii: 73913. doi: 10.7554/eLife.73913. 10.7554/eLife.73913 PubMed 35535493