Skip to main content

pMX-mPGK-CD90.2-Rluc_miR
(Plasmid #163332)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 163332 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pMX
  • Vector type
    Mammalian Expression, Retroviral, RNAi

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    CD90.2
  • Alt name
    Thy1b
  • gRNA/shRNA sequence
    AGGAATTATAATGCTTATCTA
  • Species
    M. musculus (mouse)
  • Entrez Gene
    Thy1 (a.k.a. CD90, T25, Thy-1, Thy-1.2, Thy1.1, Thy1.2)
  • Promoter mPGK

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site Unknown (unknown if destroyed)
  • 3′ cloning site Unknown (unknown if destroyed)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.

Depositor Comments

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pMX-mPGK-CD90.2-Rluc_miR was a gift from Louis Ates & Teunis Geijtenbeek (Addgene plasmid # 163332 ; http://n2t.net/addgene:163332 ; RRID:Addgene_163332)
  • For your References section:

    An optimized retroviral toolbox for overexpression and genetic perturbation of primary lymphocytes. van der Donk LEH, van der Spek J, van Duivenvoorde T, Ten Brink MS, Geijtenbeek TBH, Kuijl CP, van Heijst JWJ, Ates LS. Biol Open. 2022 Feb 15;11(2):bio059032. doi: 10.1242/bio.059032. Epub 2022 Mar 1. 10.1242/bio.059032 PubMed 35229875