pLJC6-METAP1-3xFLAG
(Plasmid
#163453)
-
Purposelentiviral overexpression vector for human METAP1
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 163453 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonepLJC6
-
Vector typeMammalian Expression, Lentiviral
-
Selectable markersBlasticidin
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameMETAP1
-
SpeciesH. sapiens (human)
-
MutationSee: comments
-
Entrez GeneMETAP1 (a.k.a. MAP1A, MetAP1A)
- Promoter Ubc
-
Tag
/ Fusion Protein
- 3xFLAG (C terminal on insert)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site PacI (not destroyed)
- 3′ cloning site NotI (not destroyed)
- 5′ sequencing primer GTAAATTGTCCGCTAAATTCTGGC
- 3′ sequencing primer CCCTTTTCTTTTAAAATTGTGGATGAATACTGCC (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Insert contains 5 silent mutations introduced to abolish recognition by sgMETAP1_2
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pLJC6-METAP1-3xFLAG was a gift from Jason Cantor (Addgene plasmid # 163453 ; http://n2t.net/addgene:163453 ; RRID:Addgene_163453) -
For your References section:
CRISPR screens in physiologic medium reveal conditionally essential genes in human cells. Rossiter NJ, Huggler KS, Adelmann CH, Keys HR, Soens RW, Sabatini DM, Cantor JR. Cell Metab. 2021 Feb 23. pii: S1550-4131(21)00061-9. doi: 10.1016/j.cmet.2021.02.005. 10.1016/j.cmet.2021.02.005 PubMed 33651980