pcDNA™5/FRT/CMV_promoter-Cas9-E2A-mRFP
(Plasmid
#164131)
-
PurposeExpresses SpCas9 and mRFP in mammalian cells (an insertion vector to generate Cas9-knockin cell lines)
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 164131 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepcDNA5-FRT
-
Backbone manufacturerThermo Fisher
- Backbone size w/o insert (bp) 4000
- Total vector size (bp) 9955
-
Vector typeMammalian Expression, CRISPR, Synthetic Biology
-
Selectable markersHygromycin
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameSpCas9
-
SpeciesSynthetic
-
Insert Size (bp)4104
-
Entrez Genecas9 (a.k.a. B6D67_RS04280, ERS445054_00848)
- Promoter CMV
Cloning Information
- Cloning method Unknown
- 5′ sequencing primer cgcaaatgggcggtaggcgtg
- 3′ sequencing primer TAGAAGGCACAGTCGAGG
- (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pcDNA™5/FRT/CMV_promoter-Cas9-E2A-mRFP was a gift from Hyongbum Kim (Addgene plasmid # 164131 ; http://n2t.net/addgene:164131 ; RRID:Addgene_164131) -
For your References section:
Recording of elapsed time and temporal information about biological events using Cas9. Park J, Lim JM, Jung I, Heo SJ, Park J, Chang Y, Kim HK, Jung D, Yu JH, Min S, Yoon S, Cho SR, Park T, Kim HH. Cell. 2021 Jan 28. pii: S0092-8674(21)00014-3. doi: 10.1016/j.cell.2021.01.014. 10.1016/j.cell.2021.01.014 PubMed 33539780