pSC201plus
(Plasmid
#164227)
-
Purpose(Empty Backbone) Integrative plasmid to introduce modified rhamnose-inducible promoter into bacterial genomes. Harbours enhanced rhaS binding site and encodes T7 gene10 stem loop in mRNA for enhanced expression
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 164227 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepSC201
-
Backbone manufacturerMiguel Valvano and Silvia Cardona
- Backbone size (bp) 5461
-
Modifications to backboneUpstream of PrhaBAD, exchanged rhaI2 site for rhaI1 (resulting in two rhaI1 sites). Downstream of PrhaBAD, added T7 gene 10 stem loop as 5' extension of mRNA.
-
Vector typeBacterial Expression, Synthetic Biology
- Promoter Rhamnose-inducible
Growth in Bacteria
-
Bacterial Resistance(s)Trimethoprim, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)Pir1
-
Copy numberLow Copy
Cloning Information
- 5′ sequencing primer GTTCTATCGCCACGGACG
- 3′ sequencing primer AACAAGCCAGGGATGTAACG
- (Common Sequencing Primers)
Resource Information
-
A portion of this plasmid was derived from a plasmid made byFlannagan et al. (2007) from University of Western Ontario. The oriR6K and oriT were cloned from pGPΩTp (Addgene plasmid #130660).
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
This plasmid is derived from pSC201, which itself was made by cloning oriR6K and oriT from pGPΩTp (available on Addgene as plasmid #130660). pGPΩTp constructed by Flannagan et al. (2007). Originally from University of Western Ontario.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pSC201plus was a gift from Silvia Cardona (Addgene plasmid # 164227 ; http://n2t.net/addgene:164227 ; RRID:Addgene_164227) -
For your References section:
Improved dynamic range of a rhamnose-inducible promoter for gene expression in Burkholderia. Hogan AM, Jeffers KR, Palacios A, Cardona ST. Appl Environ Microbiol. 2021 Jun 30:AEM0064721. doi: 10.1128/AEM.00647-21. 10.1128/AEM.00647-21 PubMed 34190606