-
PurposeA mammalian expression vector to express codon-optimized SARS-CoV-2 Spike protein, with a C terminal truncation of 18 amino acids to improve pseudoparticle generation.
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 164583 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepRP
-
Backbone manufacturerVectorbuilder
-
Vector typeMammalian Expression
-
Selectable markersNeomycin (select with G418)
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameSARS-CoV-2 Spike
-
SpeciesSARS-CoV-2
-
Insert Size (bp)3768
-
MutationDeleted amino acids 1256-1273
-
Entrez GeneS (a.k.a. GU280_gp02, spike glycoprotein)
- Promoter EF1a
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer GTGTCGTGACAAGTTTGTAC
- (Common Sequencing Primers)
Resource Information
-
A portion of this plasmid was derived from a plasmid made bySinoBiological Cat No. VG40589-UT
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Codon-optimized SARS-CoV-2 Spike was cloned from SinoBiological plasmid VG40589-UT. An 18-amino acid truncation was introduced to improve expression. The plasmid can be used to generate Spike-pseudotyped lentiviral or VSV particles.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
SARS-CoV-2 Spike-d18 was a gift from Jason Sheltzer (Addgene plasmid # 164583 ; http://n2t.net/addgene:164583 ; RRID:Addgene_164583)