Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

sgRNA(MS2)_zeo insert c-MYC
(Plasmid #164636)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 164636 Standard format: Plasmid sent in bacteria as agar stab 1 $85

Backbone

  • Vector backbone
    sgRNA(MS2)_zeo #61427
  • Modifications to backbone
    insert was cloned into BsmBI site
  • Vector type
    Mammalian Expression, Lentiviral, CRISPR
  • Selectable markers
    Zeocin

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    target sequence for c-Myc activation
  • Alt name
    Myc proto-oncogene protein
  • Species
    H. sapiens (human)
  • Insert Size (bp)
    25
  • Entrez Gene
    MYC (a.k.a. MRTL, MYCC, bHLHe39, c-Myc)
  • Promoter U6 and EF1A

Cloning Information

  • Cloning method Gateway Cloning
  • 5′ sequencing primer CACCGTTCCCCCACGCCCTCTGCTT
  • 3′ sequencing primer AAACAAGCAGAGGGCGTGGGGGAAC
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    sgRNA(MS2)_zeo insert c-MYC was a gift from Günter Schneider (Addgene plasmid # 164636 ; http://n2t.net/addgene:164636 ; RRID:Addgene_164636)