sgRNA(MS2)_zeo insert c-MYC
(Plasmid
#164636)
-
PurposesgRNA(MS2)_zeo backbone with cloned target sequence for human c-MYC. The insert sequence is: 5-CACCGTTCCCCCACGCCCTCTGCTT-3´ . This sgRNA achieves an upregulation of MYC in combination with dCAS9-VP64
-
Depositing Lab
-
Publication
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 164636 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonesgRNA(MS2)_zeo #61427
-
Modifications to backboneinsert was cloned into BsmBI site
-
Vector typeMammalian Expression, Lentiviral, CRISPR
-
Selectable markersZeocin
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nametarget sequence for c-Myc activation
-
Alt nameMyc proto-oncogene protein
-
SpeciesH. sapiens (human)
-
Insert Size (bp)25
-
Entrez GeneMYC (a.k.a. MRTL, MYCC, bHLHe39, c-Myc)
- Promoter U6 and EF1A
Cloning Information
- Cloning method Gateway Cloning
- 5′ sequencing primer CACCGTTCCCCCACGCCCTCTGCTT
- 3′ sequencing primer AAACAAGCAGAGGGCGTGGGGGAAC (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
sgRNA(MS2)_zeo insert c-MYC was a gift from Günter Schneider (Addgene plasmid # 164636 ; http://n2t.net/addgene:164636 ; RRID:Addgene_164636)