Venus-Bad-4E-pEGFP-C1
(Plasmid
#166740)
-
PurposeExpress Venus fused to the N-terminus of the Bcl-2 family protein, Bad with mutation in BH3 domain to disrupt binding anti-apoptotic proteins
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 166740 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepEGFP-C1
-
Vector typeMammalian Expression
-
Selectable markersNeomycin (select with G418)
Growth in Bacteria
-
Bacterial Resistance(s)Kanamycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameBad-4E
-
Alt nameBcl2 associated agonist of cell death, or Bcl2 like protein 8 (BCL2L8)
-
SpeciesH. sapiens (human)
-
Mutation4 hydrophobic residues in the BH3 region mutated to glutamic acid: Y110E, L114E, M117E, F122E.
-
Entrez GeneBAD (a.k.a. BBC2, BCL2L8)
- Promoter CMV
-
Tag
/ Fusion Protein
- Venus (N terminal on backbone)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site Unknown (unknown if destroyed)
- 3′ cloning site Unknown (unknown if destroyed)
- 5′ sequencing primer TGACGCAAATGGGCGGTAGG
- 3′ sequencing primer TCGCCCTTTGACGTTGGAGTCCAC
- (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
-
A portion of this plasmid was derived from a plasmid made byBad sequence aligns with Homo sapiens BAD mRNA for BCL2-antagonist of cell death protein (GenBank accession #: AB451254.1)
-
Article Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Transfection of this plasmid will express "VBad-4E" (Venus fused to the N-terminus of the BH3-only protein, Bad-4E) in live cells. There is a flexible, 7 amino acid linker between Venus and Bad-4E proteins. Full length Bad protein with BH3 region hydrophobic positions H1-H4 mutated to glutamic acid (E), refered to as "BH3-4E" mutation, BH3 mutations: Y110E, L114E, M117E, F122E. When compared with EYFP, Venus fluorophore contains the following mutations: F46L, F64L, M153T, V163A and S175G. This Venus protein contains an F224R mutation to make it monomeric.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
Venus-Bad-4E-pEGFP-C1 was a gift from David Andrews (Addgene plasmid # 166740 ; http://n2t.net/addgene:166740 ; RRID:Addgene_166740) -
For your References section:
Bim escapes displacement by BH3-mimetic anti-cancer drugs by double-bolt locking both Bcl-XL and Bcl-2. Liu Q, Osterlund EJ, Chi X, Pogmore J, Leber B, Andrews DW. Elife. 2019 Mar 12;8. pii: 37689. doi: 10.7554/eLife.37689. 10.7554/eLife.37689 PubMed 30860026