pDestTol2CG2-mnx1:mCherry-PA-Rac1
(Plasmid
#169044)
-
PurposeDestination transgenesis vector for expressing mCherry fused with an optimized photoactivatable Rac1 protein in zebrafish spinal motor neurons using 3 tandem repeats of the mnx1 enhancer.
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 169044 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepDestTol2CG2
-
Backbone manufacturerChi-Bin Chien lab
- Backbone size w/o insert (bp) 7796
- Total vector size (bp) 8730
-
Vector typeMammalian Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature30°C
-
Growth Strain(s)NEB Stable
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert namePA-Rac-1
-
Alt namePhotoactivatable Rac1
-
Alt nameLOV(Leu404-Leu546)-(L514K-L531K)-Rac1(Ile4)-Q61L/E91H/N92H
-
SpeciesH. sapiens (human); Avena sativa (oat)
-
Insert Size (bp)1005
-
MutationRac1 starts at I4 and contains mutations Q61L, E91H and N92H (results in the photoactivatable analogue of Rac1). L514K, L531K mutations in LOV domain reduce background activation.
-
GenBank IDAB451363
-
Entrez GeneRAC1 (a.k.a. MIG5, MRD48, Rac-1, TC-25, p21-Rac1)
- Promoter 3xMnx1
-
Tags
/ Fusion Proteins
- Fused with mCherry (N terminal on backbone)
- 6X His (N terminal on backbone)
Cloning Information
- Cloning method Gateway Cloning
- 5′ sequencing primer GTTTGTACAAAAAAGCAGGC
- 3′ sequencing primer CCACTTTGTACAAGAAAGCTGGGT
- (Common Sequencing Primers)
Resource Information
-
A portion of this plasmid was derived from a plasmid made byAddgene 22027
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pDestTol2CG2-mnx1:mCherry-PA-Rac1 was a gift from Paola Arlotta (Addgene plasmid # 169044 ; http://n2t.net/addgene:169044 ; RRID:Addgene_169044) -
For your References section:
Long-Range Optogenetic Control of Axon Guidance Overcomes Developmental Boundaries and Defects. Harris JM, Wang AY, Boulanger-Weill J, Santoriello C, Foianini S, Lichtman JW, Zon LI, Arlotta P. Dev Cell. 2020 Jun 8;53(5):577-588.e7. doi: 10.1016/j.devcel.2020.05.009. 10.1016/j.devcel.2020.05.009 PubMed 32516597