Skip to main content

pLEVI(408)-ColE-iLight-msfGFP
(Plasmid #170268)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 170268 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pLEVI(408)-ColE
  • Backbone manufacturer
    Y. Yang lab (East China University of Science and Technology, China), https://pubmed.ncbi.nlm.nih.gov/27311594/
  • Backbone size w/o insert (bp) 5347
  • Total vector size (bp) 7702
  • Modifications to backbone
    iLight-msfGFP was inserted C-terminally in frame with LexADBD.
  • Vector type
    Bacterial Expression
  • Selectable markers
    mCherry

Growth in Bacteria

  • Bacterial Resistance(s)
    Spectinomycin, 50 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    Low Copy

Gene/Insert

  • Gene/Insert name
    iLight
  • Species
    Synthetic; ; Idiomarina sp. A28L
  • Insert Size (bp)
    2355
  • Mutation
    To design iLight for expression in bacteria, a full-length bacterial phytochrome IsPadC from Idiomarina sp. A28L was used as an original template. First, diguanylyl cyclase effector in IsPadC was removed, then following mutations were introduced: I68F, H80Q, A86T, R90S S242C, E274K, R295H I360V, and L464V.
  • GenBank ID
    MW890755
  • Promoter pJ23116
  • Tag / Fusion Protein
    • msfGFP (C terminal on insert)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site SacII (not destroyed)
  • 3′ cloning site SalI (not destroyed)
  • 5′ sequencing primer atgaaagcgttaacggccaggcaac
  • 3′ sequencing primer cgtcgccgtccagctcgaccag
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pLEVI(408)-ColE-iLight-msfGFP was a gift from Vladislav Verkhusha (Addgene plasmid # 170268 ; http://n2t.net/addgene:170268 ; RRID:Addgene_170268)
  • For your References section:

    Single-component near-infrared optogenetic systems for gene transcription regulation. Kaberniuk AA, Baloban M, Monakhov MV, Shcherbakova DM, Verkhusha VV. Nat Commun. 2021 Jun 23;12(1):3859. doi: 10.1038/s41467-021-24212-7. 10.1038/s41467-021-24212-7 PubMed 34162879