pLEVI(408)-ColE-iLight-msfGFP
(Plasmid
#170268)
-
PurposeExpresses LexA_DBD-iLight-msfGFP under J23116 promoter and mCherry under ColE promoter with a LexA408 operator in bacteria.
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 170268 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 |
Backbone
-
Vector backbonepLEVI(408)-ColE
-
Backbone manufacturerY. Yang lab (East China University of Science and Technology, China), https://pubmed.ncbi.nlm.nih.gov/27311594/
- Backbone size w/o insert (bp) 5347
- Total vector size (bp) 7702
-
Modifications to backboneiLight-msfGFP was inserted C-terminally in frame with LexADBD.
-
Vector typeBacterial Expression
-
Selectable markersmCherry
Growth in Bacteria
-
Bacterial Resistance(s)Spectinomycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberLow Copy
Gene/Insert
-
Gene/Insert nameiLight
-
SpeciesSynthetic; ; Idiomarina sp. A28L
-
Insert Size (bp)2355
-
MutationTo design iLight for expression in bacteria, a full-length bacterial phytochrome IsPadC from Idiomarina sp. A28L was used as an original template. First, diguanylyl cyclase effector in IsPadC was removed, then following mutations were introduced: I68F, H80Q, A86T, R90S S242C, E274K, R295H I360V, and L464V.
-
GenBank IDMW890755
- Promoter pJ23116
-
Tag
/ Fusion Protein
- msfGFP (C terminal on insert)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site SacII (not destroyed)
- 3′ cloning site SalI (not destroyed)
- 5′ sequencing primer atgaaagcgttaacggccaggcaac
- 3′ sequencing primer cgtcgccgtccagctcgaccag (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pLEVI(408)-ColE-iLight-msfGFP was a gift from Vladislav Verkhusha (Addgene plasmid # 170268 ; http://n2t.net/addgene:170268 ; RRID:Addgene_170268) -
For your References section:
Single-component near-infrared optogenetic systems for gene transcription regulation. Kaberniuk AA, Baloban M, Monakhov MV, Shcherbakova DM, Verkhusha VV. Nat Commun. 2021 Jun 23;12(1):3859. doi: 10.1038/s41467-021-24212-7. 10.1038/s41467-021-24212-7 PubMed 34162879