pAAV-hSyn1-DIO-ExRai-AKAR2
(Plasmid
#171846)
-
PurposeCre-dependent, synapsin promoter-driven expression of the green fluorescent ExRai-AKAR2 PKA biosensor in neurons.
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 171846 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepAAV
-
Backbone manufacturerAgilent
- Backbone size w/o insert (bp) 4068
- Total vector size (bp) 5286
-
Vector typeMammalian Expression, AAV
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature30°C
-
Growth Strain(s)NEB Stable
-
Growth instructionsGrow at 30C for a short time to avoid ITR deletions
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameExRai-AKAR2
-
Alt nameExcitation-ratiometric A Kinase Activity Reporter 2 Biosensor
-
SpeciesSynthetic
-
Insert Size (bp)1218
- Promoter hSyn1
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer TGCGGCGCCGGCGACTCAGCGCTGCCTCAGTCTGCGGTGGG
- (Common Sequencing Primers)
Resource Information
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pAAV-hSyn1-DIO-ExRai-AKAR2 was a gift from Richard Huganir (Addgene plasmid # 171846 ; http://n2t.net/addgene:171846 ; RRID:Addgene_171846) -
For your References section:
An ultrasensitive biosensor for high-resolution kinase activity imaging in awake mice. Zhang JF, Liu B, Hong I, Mo A, Roth RH, Tenner B, Lin W, Zhang JZ, Molina RS, Drobizhev M, Hughes TE, Tian L, Huganir RL, Mehta S, Zhang J. Nat Chem Biol. 2020 Sep 28. pii: 10.1038/s41589-020-00660-y. doi: 10.1038/s41589-020-00660-y. 10.1038/s41589-020-00660-y PubMed 32989297