pTRIPZ-TIR1-HA
(Plasmid
#172610)
-
PurposeLentiviral vector for the Tet-inducible expression of HA-tagged TIR1 and a constitutive puromycin resistance marker in mammalian cells
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 172610 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonepTRIPZ
-
Backbone manufacturerHorizon Discovery
-
Vector typeMammalian Expression, Lentiviral
-
Selectable markersPuromycin
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameTIR1
-
Alt nameTransport Inhibitor Response 1
-
Alt nameosTIR1
-
SpeciesOryza sativa
- Promoter Tet/ON Minimal CMV promoter
-
Tag
/ Fusion Protein
- HA (C terminal on insert)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site Unknown (unknown if destroyed)
- 3′ cloning site Unknown (unknown if destroyed)
- 5′ sequencing primer GAACGTATGTCGAGGTAGGCG
- 3′ sequencing primer T7 (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
osTIR1 encodes the substrate receptor (Fbox protein) of a plant SCF E3 ubiquitin ligase complex known to mediate the ubiquitylation/degradation of substrates containing the auxin-inducible degron (AID) in the presence of the plant hormone auxin (indole-30-acetic acid)
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pTRIPZ-TIR1-HA was a gift from Michele Pagano (Addgene plasmid # 172610 ; http://n2t.net/addgene:172610 ; RRID:Addgene_172610) -
For your References section:
CRL4(AMBRA1) is a master regulator of D-type cyclins. Simoneschi D, Rona G, Zhou N, Jeong YT, Jiang S, Milletti G, Arbini AA, O'Sullivan A, Wang AA, Nithikasem S, Keegan S, Siu Y, Cianfanelli V, Maiani E, Nazio F, Cecconi F, Boccalatte F, Fenyo D, Jones DR, Busino L, Pagano M. Nature. 2021 Apr;592(7856):789-793. doi: 10.1038/s41586-021-03445-y. Epub 2021 Apr 14. 10.1038/s41586-021-03445-y PubMed 33854235