pSin-5HT-1.0
(Plasmid
#172882)
-
Purposemake sindbis virus of 5-HT sensor GRAB_5-HT1.0 and express in cells
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 172882 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonepSinRep5
- Backbone size w/o insert (bp) 9951
- Total vector size (bp) 11993
-
Vector typeMammalian Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert name5HT SENSOR
-
Alt name5-HT1.0
-
SpeciesH. sapiens (human)
-
Insert Size (bp)2055
- Promoter sp6
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site Xba1 (not destroyed)
- 3′ cloning site SphI (not destroyed)
- 5′ sequencing primer AGCATAGTACATTTCATCTG (Common Sequencing Primers)
Resource Information
-
A portion of this plasmid was derived from a plasmid made byFrom Yulong Li
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pSin-5HT-1.0 was a gift from J. Julius Zhu (Addgene plasmid # 172882 ; http://n2t.net/addgene:172882 ; RRID:Addgene_172882) -
For your References section:
A genetically encoded sensor for measuring serotonin dynamics. Wan J, Peng W, Li X, Qian T, Song K, Zeng J, Deng F, Hao S, Feng J, Zhang P, Zhang Y, Zou J, Pan S, Shin M, Venton BJ, Zhu JJ, Jing M, Xu M, Li Y. Nat Neurosci. 2021 Apr 5. pii: 10.1038/s41593-021-00823-7. doi: 10.1038/s41593-021-00823-7. 10.1038/s41593-021-00823-7 PubMed 33821000