-
PurposeRecoded E. coli strain without TCG, TCA, or TAG codons and deleted serT, serU and prfA genes. Full sequence - Genbank: CP071799.1
-
Depositing Lab
-
Sequence Information
-
Full plasmid sequence is not available for this item.
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Bacterial Strain | 174514 | Bacteria in agar stab | 1 | $89 | |
Backbone
-
Vector backboneNA
Growth in Bacteria
-
Bacterial Resistance(s)Streptomycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)This is a recoded E.coli strain
-
Growth instructionsStreptomycin resistant by virtue of K43R mutation in rpsL. Grow in LB or 2xYT, 100 micrograms/mL streptomycin to maintain
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameRecoded E. coli strain without TCG, TCA, or TAG codons in the open reading frames and deleted serT, serU and prfA genes
-
GenBank IDCP071799.1
Resource Information
-
Supplemental Documents
-
Articles Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
From the Syn61 strain (Addgene #174513), two rounds of parallel mutagenesis and dynamic selection were followed by deletion of the serT, serU and prfA genes, and a further three rounds of parallel mutagenesis and dynamic selection yielded Syn61Δ3(ev5) (Addgene #174514).
Genotyping primers for presence of synthetic insert in 100k01 in Syn61 strain:
GE282 AAAAAGGTCGGGCCGGACGGTC
GE283 GCAATAATGGCAGCCACACCTTG
Genotyping for deletion of serU gene:
GE1147 TACGAATGATGCCTCGCCGCAAATAAG
GE1148 CCTCACGCAACGGAATAAAGGGAACTC
Genotyping for deletion of serT gene:
GE1215 AGCGTCAGGCTCAGCAGAAAATAGG
GE1216 ACGTCCCTGTAGCAAGGCAAACCATC
Genotyping for deletion of prfA gene:
v13-1011 GACTAACCGCTTGATCCATGCGC
v13-1012 CAAGTTGCTGACATTGTTCGTCAGTCAGC
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
Syn61Δ3(ev5) was a gift from Jason W Chin (Addgene plasmid # 174514) -
For your References section:
Sense codon reassignment enables viral resistance and encoded polymer synthesis. Robertson WE, Funke LFH, de la Torre D, Fredens J, Elliott TS, Spinck M, Christova Y, Cervettini D, Boge FL, Liu KC, Buse S, Maslen S, Salmond GPC, Chin JW. Science. 2021 Jun 4;372(6546):1057-1062. doi: 10.1126/science.abg3029. 10.1126/science.abg3029 PubMed 34083482