pCAG-lox-rox-STOP-rox-lynScarlet-lox-Lyn-NeonGreen
(Plasmid
#175259)
-
PurposeDual plasmid labeling membrane target protein of different neuronal population with different fluorophore
-
Depositing Labs
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 175259 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepCAG-loxSTOPlox-LynNeon
- Backbone size w/o insert (bp) 5570
-
Vector typeMammalian Expression, Cre/Lox ; Dre/Rox
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameLox-rox-STOP-rox-lyn-mScarlet-pA-lox
-
SpeciesH. sapiens (human)
-
Insert Size (bp)1914
-
MutationNone (wt)
- Promoter pCAG
-
Tag
/ Fusion Protein
- mScarlet (C terminal on insert)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site PacI (not destroyed)
- 3′ cloning site PstI (not destroyed)
- 5′ sequencing primer pCAG forward (GCAACGTGCTGGTTATTGTG)
- 3′ sequencing primer NeonGFP reverse (5’-GGAGAGAGGCCATGTTATCC-3’)
- (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Additional Primers:
mCherry forward (5'-ccccgtaatgcagaagaaga-3’) and mCherry reverse
(5'-TTGGTCACCTTCAGCTTGG-3’)
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pCAG-lox-rox-STOP-rox-lynScarlet-lox-Lyn-NeonGreen was a gift from Frank Bradke & Sebastián Dupraz (Addgene plasmid # 175259 ; http://n2t.net/addgene:175259 ; RRID:Addgene_175259) -
For your References section:
In Situ Visualization of Axon Growth and Growth Cone Dynamics in Acute Ex Vivo Embryonic Brain Slice Cultures. Alfadil E, Bradke F, Dupraz S. J Vis Exp. 2021 Oct 14;(176). doi: 10.3791/63068. 10.3791/63068 PubMed 34723948