-
PurposeExpression of dCas12f-VPR-mCherry in mammalian cells
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 176268 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonepHR
-
Vector typeMammalian Expression, Lentiviral
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert namedCas12f
-
Alt namenuclease-deactivated Un1Cas12f1
-
MutationD326A, D510A
- Promoter PGK
-
Tag
/ Fusion Protein
- HA-VPR-mCherry (C terminal on insert)
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer CAAAAGCGCACGTCTGCCGC (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pSLQ7334: pHR-PGK-SV40_NLS-dCas12f-VPR-c- Myc_NLS-mCherry-WPRE was a gift from Stanley Qi (Addgene plasmid # 176268 ; http://n2t.net/addgene:176268 ; RRID:Addgene_176268) -
For your References section:
Engineered miniature CRISPR-Cas system for mammalian genome regulation and editing. Xu X, Chemparathy A, Zeng L, Kempton HR, Shang S, Nakamura M, Qi LS. Mol Cell. 2021 Aug 26. pii: S1097-2765(21)00648-1. doi: 10.1016/j.molcel.2021.08.008. 10.1016/j.molcel.2021.08.008 PubMed 34480847