- 
            PurposeExpression of CasMINI sgRNA targeting TRE3G promoter in dCasMINI-mediated GFP activation assays.
- 
              Depositing Lab
- 
          Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 176273 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
- 
            Vector backbonepHR
- 
              Vector typeMammalian Expression, Lentiviral
- 
                Selectable markersPuromycin
Growth in Bacteria
- 
            Bacterial Resistance(s)Ampicillin, 100 μg/mL
- 
            Growth Temperature37°C
- 
            Growth Strain(s)NEB Stable
- 
            Copy numberUnknown
Gene/Insert
- 
                Gene/Insert nameCasMINI sgRNA (sgTet) and BFP
- 
                    gRNA/shRNA sequenceCTCCCTATCAGTGATAGAGAACG
- Promoter U6
Cloning Information
- Cloning method Unknown
- 5′ sequencing primer gactatcatatgcttaccgtaac (Common Sequencing Primers)
Resource Information
- 
            
            
            Supplemental Documents
Terms and Licenses
- 
        Academic/Nonprofit Terms
- 
      Industry Terms- Not Available to Industry
 
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
- 
              For your Materials & Methods section: pSLQ9834_sgTet: pHR-hU6-CasMINI sgRNA_#2 (sgTet); EF1a-Puro-T2A-BFP- WPRE was a gift from Stanley Qi (Addgene plasmid # 176273 ; http://n2t.net/addgene:176273 ; RRID:Addgene_176273)
- 
                For your References section: Engineered miniature CRISPR-Cas system for mammalian genome regulation and editing. Xu X, Chemparathy A, Zeng L, Kempton HR, Shang S, Nakamura M, Qi LS. Mol Cell. 2021 Aug 26. pii: S1097-2765(21)00648-1. doi: 10.1016/j.molcel.2021.08.008. 10.1016/j.molcel.2021.08.008 PubMed 34480847
