Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected] Learn more

pSLQ9834_sgTet: pHR-hU6-CasMINI sgRNA_#2 (sgTet); EF1a-Puro-T2A-BFP- WPRE
(Plasmid #176273)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 176273 Standard format: Plasmid sent in bacteria as agar stab 1 $85

This material is available to academics and nonprofits only.

Backbone

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    CasMINI sgRNA (sgTet) and BFP
  • gRNA/shRNA sequence
    CTCCCTATCAGTGATAGAGAACG
  • Promoter U6

Cloning Information

Resource Information

Terms and Licenses

Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pSLQ9834_sgTet: pHR-hU6-CasMINI sgRNA_#2 (sgTet); EF1a-Puro-T2A-BFP- WPRE was a gift from Stanley Qi (Addgene plasmid # 176273 ; http://n2t.net/addgene:176273 ; RRID:Addgene_176273)
  • For your References section:

    Engineered miniature CRISPR-Cas system for mammalian genome regulation and editing. Xu X, Chemparathy A, Zeng L, Kempton HR, Shang S, Nakamura M, Qi LS. Mol Cell. 2021 Aug 26. pii: S1097-2765(21)00648-1. doi: 10.1016/j.molcel.2021.08.008. 10.1016/j.molcel.2021.08.008 PubMed 34480847