Skip to main content

lenti-sgRNA(MS2)_zeo_hCYP3A4_enhancer_guide1
(Plasmid #176839)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 176839 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    lenti-sgRNA(MS2)_zeo
  • Vector type
    Mammalian Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    30°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    Human CYP3A4 proximal enhancer sgRNA for activation
  • gRNA/shRNA sequence
    GATTCACCTGGGGTCAACAC
  • Species
    H. sapiens (human)
  • Promoter U6

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site BsmbI (destroyed during cloning)
  • 3′ cloning site BsmbI (destroyed during cloning)
  • 5′ sequencing primer gagggcctatttcccatgattcc
  • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.

Depositor Comments

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    lenti-sgRNA(MS2)_zeo_hCYP3A4_enhancer_guide1 was a gift from Rudolf Jaenisch (Addgene plasmid # 176839 ; http://n2t.net/addgene:176839 ; RRID:Addgene_176839)
  • For your References section:

    The nuclear receptor THRB facilitates differentiation of human PSCs into more mature hepatocytes. Ma H, de Zwaan E, Guo YE, Cejas P, Thiru P, van de Bunt M, Jeppesen JF, Syamala S, Dall'Agnese A, Abraham BJ, Fu D, Garrett-Engele C, Lee TI, Long HW, Griffith LG, Young RA, Jaenisch R. Cell Stem Cell. 2022 Apr 13. pii: S1934-5909(22)00150-3. doi: 10.1016/j.stem.2022.03.015. 10.1016/j.stem.2022.03.015 PubMed 35452598