AAVS1-SA-neo-CAGGS-PE2-2A-GFP
(Plasmid
#180014)
-
PurposeTargeting vector for knocking in constitutively expressed PE2-2A-GFP into the human AAVS1 locus
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 180014 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backboneunknown
-
Vector typeCRISPR ; Human genome engineering
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature30°C
-
Growth Strain(s)Stbl3
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert namePE2-2A-GFP
-
SpeciesSynthetic
-
Insert Size (bp)7244
- Promoter CAG
-
Tag
/ Fusion Protein
- GFP (C terminal on insert)
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer SP-CAGGS (TTCGGCTTCTGGCGTGTG)
- 3′ sequencing primer ASP_AAVS1-HR-R (TCACCAATCCTGTCCCTAGT)
- (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
AAVS1-SA-neo-CAGGS-PE2-2A-GFP was a gift from Dirk Hockemeyer (Addgene plasmid # 180014 ; http://n2t.net/addgene:180014 ; RRID:Addgene_180014) -
For your References section:
Highly efficient generation of isogenic pluripotent stem cell models using prime editing. Li H, Busquets O, Verma Y, Syed KM, Kutnowski N, Pangilinan GR, Gilbert LA, Bateup HS, Rio DC, Hockemeyer D, Soldner F. Elife. 2022 Sep 7;11:e79208. doi: 10.7554/eLife.79208. 10.7554/eLife.79208 PubMed 36069759