M8
(Plasmid
#180253)
-
PurposeVaccine vector encoding 8 neonatigens specific for the MC38 colon cancer mouse model
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 180253 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepTK1-TPA
- Backbone size w/o insert (bp) 4967
- Total vector size (bp) 5638
-
Vector typeMammalian Expression ; vaccine vector
Growth in Bacteria
-
Bacterial Resistance(s)Kanamycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameSynthetic gene encoding for 8 neonatigens specific for MC38 mouse cancer cells
-
SpeciesM. musculus (mouse)
-
Insert Size (bp)696
-
Mutationthe polyepitope vaccine encodes for mutated sequence expressed in the MC38 tumor model
-
GenBank IDNM_001359282.1
- Promoter CMV
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site PacI (unknown if destroyed)
- 3′ cloning site NotI (unknown if destroyed)
- 5′ sequencing primer GAGGGCAGTGTAGTCTGAGCAGTACTCG
- 3′ sequencing primer GGACAGTGGGAGTGGCACCTTCC
- (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
M8 was a gift from Fabio Palombo (Addgene plasmid # 180253 ; http://n2t.net/addgene:180253 ; RRID:Addgene_180253) -
For your References section:
Neoantigen cancer vaccine augments anti-CTLA-4 efficacy. Salvatori E, Lione L, Compagnone M, Pinto E, Conforti A, Ciliberto G, Aurisicchio L, Palombo F. NPJ Vaccines. 2022 Feb 2;7(1):15. doi: 10.1038/s41541-022-00433-9. 10.1038/s41541-022-00433-9 PubMed 35110563