pTRIP TRE-BI GFP10-RHOA/RBD-GFP11
(Plasmid
#182232)
-
PurposeInducible coexpression of GFP10-RHOA and RBD-GFP11 domain
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 182232 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepTRIP TRE
- Backbone size w/o insert (bp) 10000
- Total vector size (bp) 10798
-
Vector typeLentiviral
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberHigh Copy
Gene/Insert 1
-
Gene/Insert nameras homolog family member A
-
SpeciesH. sapiens (human)
-
GenBank IDNM 001313944
-
Entrez GeneRHOA (a.k.a. ARH12, ARHA, EDFAOB, RHO12, RHOH12)
- Promoter TRE bidirectional
-
Tag
/ Fusion Protein
- GFP10 (split-GFP tripartite) (N terminal on insert)
Cloning Information for Gene/Insert 1
- Cloning method Restriction Enzyme
- 5′ cloning site SacII (unknown if destroyed)
- 3′ cloning site NheI (unknown if destroyed)
- 5′ sequencing primer ATTTCGAGCTCGGTACCG
- 3′ sequencing primer gtggctaagatctacagctg
- (Common Sequencing Primers)
Gene/Insert 2
-
Gene/Insert namerhotekin RHO binding domain (RBD)
-
SpeciesM. musculus (mouse)
-
Insert Size (bp)252
-
GenBank IDNM_001136227.1
- Promoter TRE bidirectional
-
Tag
/ Fusion Protein
- GFP11 (M4) (C terminal on insert)
Cloning Information for Gene/Insert 2
- Cloning method Restriction Enzyme
- 5′ cloning site NdeI (not destroyed)
- 3′ cloning site XbaI (not destroyed)
- 5′ sequencing primer CTGGAGAATTCACCGGTCATATG
- 3′ sequencing primer ggacagcagagatccactt
- (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pTRIP TRE-BI GFP10-RHOA/RBD-GFP11 was a gift from Stéphanie Cabantous (Addgene plasmid # 182232 ; http://n2t.net/addgene:182232 ; RRID:Addgene_182232) -
For your References section:
High-content tripartite split-GFP cell-based assays to screen for modulators of small GTPase activation. Koraichi F, Gence R, Bouchenot C, Grosjean S, Lajoie-Mazenc I, Favre G, Cabantous S. J Cell Sci. 2018 Jan 8;131(1). pii: jcs.210419. doi: 10.1242/jcs.210419. 10.1242/jcs.210419 PubMed 29192060