Skip to main content

PB-TO-NFIA.1-SOX9 (bi-directional promoter)
(Plasmid #182306)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 182306 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pUCM
  • Backbone size w/o insert (bp) 13000
  • Total vector size (bp) 16660
  • Vector type
    Mammalian Expression ; PiggyBac
  • Selectable markers
    Puromycin

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert 1

  • Gene/Insert name
    NFIA
  • Species
    H. sapiens (human)
  • Insert Size (bp)
    1530
  • Entrez Gene
    NFIA (a.k.a. BRMUTD, C1DELp32p31, CTF, DEL1P32P31, NF-I/A, NF1-A, NFI-A, NFI-L)
  • Promoter TRE3G-Bi-directional
  • Tag / Fusion Protein
    • None

Cloning Information for Gene/Insert 1

  • Cloning method Restriction Enzyme
  • 5′ cloning site PmeI (not destroyed)
  • 3′ cloning site NruI (not destroyed)
  • 5′ sequencing primer ccgtaccacttcctaccctc
  • 3′ sequencing primer caagttggggtgggcgat
  • (Common Sequencing Primers)

Gene/Insert 2

  • Gene/Insert name
    SOX9
  • Species
    H. sapiens (human)
  • Insert Size (bp)
    1527
  • Entrez Gene
    SOX9 (a.k.a. CMD1, CMPD1, ENH13, SRA1, SRXX2, SRXY10, TES, TESCO)
  • Promoter TRE3G-Bi-directional
  • Tag / Fusion Protein
    • None

Cloning Information for Gene/Insert 2

  • Cloning method Restriction Enzyme
  • 5′ cloning site AscI (not destroyed)
  • 3′ cloning site AvrII (not destroyed)
  • 5′ sequencing primer atgtggcttgagctgtaggc
  • (Common Sequencing Primers)

Gene/Insert 3

  • Gene/Insert name
    puroR-T2A-mycNLS-mTagBFP2
  • Insert Size (bp)
    1473
  • Tag / Fusion Protein
    • T2A-mycNLS-mTagBFP2

Resource Information

  • Supplemental Documents
  • A portion of this plasmid was derived from a plasmid made by
    Michael Ward lab

Terms and Licenses

Trademarks:

  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    PB-TO-NFIA.1-SOX9 (bi-directional promoter) was a gift from iPSC Neurodegenerative Disease Initiative (iNDI) & Michael Ward (Addgene plasmid # 182306 ; http://n2t.net/addgene:182306 ; RRID:Addgene_182306)