pPyPGK-EGFP-TM-IRES-Pac
(Plasmid
#183604)
-
PurposeMammalian expression vector for membrane-tethered EGFP from the mouse Pgk1 promoter. Confers puromycin resistance.
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 183604 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepPyCAG-IRES-Pac
- Backbone size w/o insert (bp) 5236
- Total vector size (bp) 6240
-
Vector typeMammalian Expression
-
Selectable markersPuromycin
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameEGFP-TM
-
SpeciesSynthetic
-
Insert Size (bp)933
- Promoter Mouse Pgk1
-
Tags
/ Fusion Proteins
- Mouse IgGK signal peptide (N terminal on insert)
- Human PDGFRB transmembrane domain (C terminal on insert)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site XhoI (not destroyed)
- 3′ cloning site NotI (not destroyed)
- 5′ sequencing primer CATTCTGCACGCTTCAAAAG
- 3′ sequencing primer GCATTCCTTTGGCGAGAG
- (Common Sequencing Primers)
Resource Information
-
A portion of this plasmid was derived from a plasmid made byThe EGFP-TM cassette was a kind gift of Dr Wendell Lim and Dr Leonardo Morsut (Addgene plasmid 79129).
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pPyPGK-EGFP-TM-IRES-Pac was a gift from Sally Lowell (Addgene plasmid # 183604 ; http://n2t.net/addgene:183604 ; RRID:Addgene_183604) -
For your References section:
SyNPL: Synthetic notch pluripotent cell lines to monitor and manipulate cell interactions in vitro and in vivo. Malaguti M, Migueles RP, Annoh J, Sadurska D, Blin G, Lowell S. Development. 2022 May 26. pii: 275525. doi: 10.1242/dev.200226. 10.1242/dev.200226 PubMed 35616331