pPyPGK-Myc-LaG17-SynNotch-tTA-IRES-Ble
(Plasmid #183607)

• Purpose: Mammalian expression vector: mouse Pgk1 promoter driving expression of a SynNotch receptor comprising anti-GFP nanobody (LaG17), mouse Notch1 core, tTA. Confers bleomycin/zeocin resistance.
• Depositing Lab: Sally Lowell
• Publication: Malaguti et al Development. 2022 May 26. pii: 275525. doi: 10.1242/dev.200226.

Backbone

• Vector backbone: pPyPGK-IRES-Ble
• Backbone size w/o insert (bp): 5272
• Total vector size (bp): 7510
• Vector type: Mammalian Expression
• Selectable markers: Zeocin

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: LaG17 GFP nanobody SynNotch tTA
• Species: Synthetic
• Insert Size (bp): 2238
• Promoter: Mouse Pgk1
• Tags / Fusion Proteins:
  • human CD8a signal sequence (N terminal on insert)
  • Myc (N terminal on insert)

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: XhoI (not destroyed)
• 3′ cloning site: Bsu36I (not destroyed)
• 5′ sequencing primer: CATTCTGCACGCTTCAAAAG
• 3′ sequencing primer: GCATTCCTTTGGCGAGAG

Resource Information

• A portion of this plasmid was derived from a plasmid made by: The Myc-LaG17-SynNotch-tTA cassette was a kind gift of Dr Wendell Lim and Dr Leonardo Morsut (Addgene plasmid 79128).

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry