Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.
We have implemented updates to our Transparency and Privacy Policy.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected] Learn more

pPyPGK-EGFP-TM-IRES-Pac
(Plasmid #183604)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 183604 Standard format: Plasmid sent in bacteria as agar stab 1 $75

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    pPyCAG-IRES-Pac
  • Backbone size w/o insert (bp) 5236
  • Total vector size (bp) 6240
  • Vector type
    Mammalian Expression
  • Selectable markers
    Puromycin

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    EGFP-TM
  • Species
    Synthetic
  • Insert Size (bp)
    933
  • Promoter Mouse Pgk1
  • Tags / Fusion Proteins
    • Mouse IgGK signal peptide (N terminal on insert)
    • Human PDGFRB transmembrane domain (C terminal on insert)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site XhoI (not destroyed)
  • 3′ cloning site NotI (not destroyed)
  • 5′ sequencing primer CATTCTGCACGCTTCAAAAG
  • 3′ sequencing primer GCATTCCTTTGGCGAGAG
  • (Common Sequencing Primers)

Resource Information

  • Supplemental Documents
  • A portion of this plasmid was derived from a plasmid made by
    The EGFP-TM cassette was a kind gift of Dr Wendell Lim and Dr Leonardo Morsut (Addgene plasmid 79129).

Terms and Licenses

Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pPyPGK-EGFP-TM-IRES-Pac was a gift from Sally Lowell (Addgene plasmid # 183604 ; http://n2t.net/addgene:183604 ; RRID:Addgene_183604)
  • For your References section:

    SyNPL: Synthetic notch pluripotent cell lines to monitor and manipulate cell interactions in vitro and in vivo. Malaguti M, Migueles RP, Annoh J, Sadurska D, Blin G, Lowell S. Development. 2022 May 26. pii: 275525. doi: 10.1242/dev.200226. 10.1242/dev.200226 PubMed 35616331