Skip to main content
Addgene

pODN-AAVS1-mNG-CAAX
(Plasmid #183870)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 183870 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pJET1.2
  • Backbone manufacturer
    Thermo Fischer Scientific
  • Backbone size w/o insert (bp) 2974
  • Total vector size (bp) 6724
  • Vector type
    Mammalian Expression, CRISPR ; Donor template

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    AAVS1 homology arms with CMV-driven mNeonGreen-CAAX fusion
  • Alt name
    AAVS1
  • Species
    H. sapiens (human)
  • Insert Size (bp)
    3752
  • Mutation
    Homology arms contain point mutations to remove the sgRNA target site
  • Entrez Gene
    AAVS1 (a.k.a. AAV)
  • Promoter CMV
  • Tag / Fusion Protein
    • mNeonGreen-CAAX

Cloning Information

  • Cloning method Unknown
  • 5′ sequencing primer CAACTGCTTTAACACTTGTGCCTG
  • 3′ sequencing primer GTTCCTGATGAGGTGGTTAGCATAG
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pODN-AAVS1-mNG-CAAX was a gift from Alisa Piekny (Addgene plasmid # 183870 ; http://n2t.net/addgene:183870 ; RRID:Addgene_183870)
  • For your References section:

    Cytokinetic diversity in mammalian cells is revealed by the characterization of endogenous anillin, Ect2 and RhoA. Husser MC, Ozugergin I, Resta T, Martin VJJ, Piekny AJ. Open Biol. 2022 Nov;12(11):220247. doi: 10.1098/rsob.220247. Epub 2022 Nov 23. 10.1098/rsob.220247 PubMed 36416720