pEGFP_IRES_tdTomato
(Plasmid
#184046)
-
PurposeExpresses EGFP and tdTomato in mammalian cells under control of a CMV promoter by using an IRES sequence
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 184046 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepEGFP-C1
-
Backbone manufacturerClontech
- Backbone size w/o insert (bp) 3300
- Total vector size (bp) 6261
-
Modifications to backboneF1 origin removed
-
Vector typeMammalian Expression
-
Selectable markersNeomycin (select with G418)
Growth in Bacteria
-
Bacterial Resistance(s)Kanamycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert 1
-
Gene/Insert nameEnhanced Green Fluorescent Protein
-
Alt nameEGFP
-
SpeciesSynthetic
-
Insert Size (bp)717
- Promoter CMV
Cloning Information for Gene/Insert 1
- Cloning method Gibson Cloning
- 5′ sequencing primer CGTCGCCGTCCAGCTCGACCAG
- 3′ sequencing primer CATGGTCCTGCTGGAGTTCGTG (Common Sequencing Primers)
Gene/Insert 2
-
Gene/Insert nametdTomato
-
SpeciesSynthetic
- Promoter CMV
Cloning Information for Gene/Insert 2
- Cloning method Gibson Cloning
- 5′ sequencing primer gatccgtacgGCCACCATGGTGAGCAAGG
- 3′ sequencing primer GAGAATTAAGCTCTACTTGTACAGCTCGTCCATGC (Common Sequencing Primers)
Gene/Insert 3
-
Gene/Insert nameInternal Ribosome Entry Site
-
Alt nameIRES
-
SpeciesHuman Poliovirus 1 Mahoney
-
Insert Size (bp)581
- Promoter CMV
Cloning Information for Gene/Insert 3
- Cloning method Gibson Cloning
- 5′ sequencing primer GTACAAGTAActcgagtactccggtattgcgg
- 3′ sequencing primer ccatggtggccgtacggatcctatccaattcgc (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pEGFP_IRES_tdTomato was a gift from Angela Pannier (Addgene plasmid # 184046 ; http://n2t.net/addgene:184046 ; RRID:Addgene_184046) -
For your References section:
Systematic comparison of nonviral gene delivery strategies for efficient co-expression of two transgenes in human mesenchymal stem cells. Kozisek T, Samuelson L, Hamann A, Pannier AK. J Biol Eng. 2023 Dec 7;17(1):76. doi: 10.1186/s13036-023-00394-0. 10.1186/s13036-023-00394-0 PubMed 38062439