Skip to main content

pCW empty vector
(Plasmid #184708)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 184708 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pCW-Cas9
  • Backbone size (bp) 7600
  • Modifications to backbone
    Removed insert (humanized S. pyogenes Cas9)
  • Vector type
    Mammalian Expression, Lentiviral
  • Selectable markers
    Puromycin

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    High Copy

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ sequencing primer AGCTCGTTTAGTGAACCGTCAGATC
  • 3′ sequencing primer CACATTCTTCACGTCCGTTC
  • (Common Sequencing Primers)

Resource Information

  • A portion of this plasmid was derived from a plasmid made by
    Eric Lander & David Sabatini (Cas9 was removed from Addgene plasmid #50661 and MCS was inserted).
  • Articles Citing this Plasmid

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.

Depositor Comments

This plasmid was derived from the lentiviral vector pCW-Cas9 ( Eric Lander & David Sabatini, Addgene plasmid #50661).
Cas9 insert was removed and substituted by a Multiple Cloning Site harbouring the following restriction sites: NheI - EcoRI - HpaI - MluI - BamHI.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pCW empty vector was a gift from Alessia Ciarrocchi & Gloria Manzotti (Addgene plasmid # 184708 ; http://n2t.net/addgene:184708 ; RRID:Addgene_184708)
  • For your References section:

    OVOL2 impairs RHO GTPase signaling to restrain mitosis and aggressiveness of Anaplastic Thyroid Cancer. Gugnoni M, Manzotti G, Vitale E, Sauta E, Torricelli F, Reggiani F, Pistoni M, Piana S, Ciarrocchi A. J Exp Clin Cancer Res. 2022 Mar 25;41(1):108. doi: 10.1186/s13046-022-02316-2. 10.1186/s13046-022-02316-2 PubMed 35337349