-
PurposeExpresses codon-optimized full length SARS-CoV-2 BA.1 Spike
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 185452 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 * | |
* Log in to view industry pricing.
Backbone
-
Vector backbonepCAGGS
- Backbone size w/o insert (bp) 4717
- Total vector size (bp) 8530
-
Vector typeMammalian Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameSARS-CoV-2 Spike BA.1
-
Alt nameOmicron Spike
-
Insert Size (bp)3813
-
MutationContains the following mutations: A67V, Δ69-70, T95I, G142D/Δ143-145, Δ211/L212I, ins214EPE, G339D, S371L, S373P, S375F, K417N, N440K, G446S, S477N, T478K, E484A, Q493R, G496S, Q498R, N501Y, Y505H, T547K, D614G, H655Y, N679K, P681H, N764K, D796Y, N856K, Q954H, N969K, L981F
-
Entrez GeneS (a.k.a. GU280_gp02, spike glycoprotein)
- Promoter chicken β-actin promoter, CMV enhancer
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site EcoRI (not destroyed)
- 3′ cloning site NheI (not destroyed)
- 5′ sequencing primer CTCTAGAGCCTCTGCTAACCATGTTC
- (Common Sequencing Primers)
Resource Information
-
Articles Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pCAGGS SARS-CoV-2 BA.1 Spike was a gift from Marceline Côté (Addgene plasmid # 185452 ; http://n2t.net/addgene:185452 ; RRID:Addgene_185452) -
For your References section:
SARS-CoV-2 Omicron Spike recognition by plasma from individuals receiving BNT162b2 mRNA vaccination with a 16-week interval between doses. Chatterjee D, Tauzin A, Marchitto L, Gong SY, Boutin M, Bourassa C, Beaudoin-Bussieres G, Bo Y, Ding S, Laumaea A, Vezina D, Perreault J, Gokool L, Morrisseau C, Arlotto P, Fournier E, Guilbault A, Delisle B, Levade I, Goyette G, Gendron-Lepage G, Medjahed H, De Serres G, Tremblay C, Martel-Laferriere V, Kaufmann DE, Bazin R, Prevost J, Moreira S, Richard J, Cote M, Finzi A. Cell Rep. 2022 Mar 1;38(9):110429. doi: 10.1016/j.celrep.2022.110429. Epub 2022 Feb 8. 10.1016/j.celrep.2022.110429 PubMed 35216664