Skip to main content
Addgene
Open Menu

pCAGGS SARS-CoV-2 BA.1 Spike
(Plasmid #185452)

Print

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 185452 Standard format: Plasmid sent in bacteria as agar stab 1 $94 *
Add to Cart
DNA 185452-D50 50 μg of DNA in Tris buffer $495 *
Add to Cart
DNA 185452-D100 100 μg of DNA in Tris buffer $585 *
Add to Cart

* Log in to view industry pricing.

Backbone

  • Vector backbone
    pCAGGS
  • Backbone size w/o insert (bp) 4717
  • Total vector size (bp) 8530
  • Vector type
    Mammalian Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    SARS-CoV-2 Spike BA.1
  • Alt name
    Omicron Spike
  • Insert Size (bp)
    3813
  • Mutation
    Contains the following mutations: A67V, Δ69-70, T95I, G142D/Δ143-145, Δ211/L212I, ins214EPE, G339D, S371L, S373P, S375F, K417N, N440K, G446S, S477N, T478K, E484A, Q493R, G496S, Q498R, N501Y, Y505H, T547K, D614G, H655Y, N679K, P681H, N764K, D796Y, N856K, Q954H, N969K, L981F
  • Entrez Gene
    S (a.k.a. GU280_gp02, spike glycoprotein)
  • Promoter chicken β-actin promoter, CMV enhancer

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site EcoRI (not destroyed)
  • 3′ cloning site NheI (not destroyed)
  • 5′ sequencing primer CTCTAGAGCCTCTGCTAACCATGTTC
  • (Common Sequencing Primers)

Terms and Licenses

Trademarks:

  • Zeocin® is an InvivoGen trademark.

Purpose

Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.

Delivery

  • Amount 50 μg
  • Concentration 1 μg/μL
  • Pricing $495 USD
  • Storage 4 ℃ (short-term) or -20 ℃ (long-term)

Terms and Licenses

Quality Control

Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.

Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.

Purpose

Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.

Delivery

  • Amount 100 μg
  • Concentration 1 μg/μL
  • Pricing $585 USD
  • Storage 4 ℃ (short-term) or -20 ℃ (long-term)

Terms and Licenses

Quality Control

Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.

Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pCAGGS SARS-CoV-2 BA.1 Spike was a gift from Marceline Côté (Addgene plasmid # 185452 ; http://n2t.net/addgene:185452 ; RRID:Addgene_185452)

  • For your References section:

    SARS-CoV-2 Omicron Spike recognition by plasma from individuals receiving BNT162b2 mRNA vaccination with a 16-week interval between doses. Chatterjee D, Tauzin A, Marchitto L, Gong SY, Boutin M, Bourassa C, Beaudoin-Bussieres G, Bo Y, Ding S, Laumaea A, Vezina D, Perreault J, Gokool L, Morrisseau C, Arlotto P, Fournier E, Guilbault A, Delisle B, Levade I, Goyette G, Gendron-Lepage G, Medjahed H, De Serres G, Tremblay C, Martel-Laferriere V, Kaufmann DE, Bazin R, Prevost J, Moreira S, Richard J, Cote M, Finzi A. Cell Rep. 2022 Mar 1;38(9):110429. doi: 10.1016/j.celrep.2022.110429. Epub 2022 Feb 8. 10.1016/j.celrep.2022.110429 PubMed 35216664
Related items:
Commonly requested with: