pegRNA-HEK3_del1-5-NGG
(Plasmid
#185478)
-
PurposepegRNA plasmid in order to make a 5 basepair deletion at the HEK3 locus, uses an NGG-PAM site.
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 185478 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 |
Backbone
-
Vector backbonepU6-pegRNA-GG-acceptor
-
Backbone manufacturerDavid Liu
- Backbone size w/o insert (bp) 3004
- Total vector size (bp) 2322
-
Vector typeMammalian Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameHEK3_del1-5-NGG pegRNA
-
gRNA/shRNA sequenceGGCCCAGACTGAGCACGTGA
-
SpeciesSynthetic
- Promoter U6
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site BsaI (destroyed during cloning)
- 3′ cloning site BsaI (destroyed during cloning)
- 5′ sequencing primer gactatcatatgcttaccgt (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pegRNA-HEK3_del1-5-NGG was a gift from Sabine Fuchs (Addgene plasmid # 185478 ; http://n2t.net/addgene:185478 ; RRID:Addgene_185478) -
For your References section:
Mutation-specific reporter for optimization and enrichment of prime editing. Schene IF, Joore IP, Baijens JHL, Stevelink R, Kok G, Shehata S, Ilcken EF, Nieuwenhuis ECM, Bolhuis DP, van Rees RCM, Spelier SA, van der Doef HPJ, Beekman JM, Houwen RHJ, Nieuwenhuis EES, Fuchs SA. Nat Commun. 2022 Mar 1;13(1):1028. doi: 10.1038/s41467-022-28656-3. 10.1038/s41467-022-28656-3 PubMed 35232966