pCAGGS SARS-CoV-2 BA.2 Spike
(Plasmid
#185604)
-
PurposeExpresses codon-optimized full length SARS-CoV-2 BA.2 Spike
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 185604 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 * |
* Log in to view industry pricing.
Backbone
-
Vector backbonepCAGGS
- Backbone size w/o insert (bp) 4716
- Total vector size (bp) 8529
-
Vector typeMammalian Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameSARS-CoV-2 BA.2 Spike
-
Alt nameSARS CoV-2 Omicron S
-
Insert Size (bp)3813
-
MutationT19I, L24S, Δ25-27, G142D, V213G, G339D, S371F, S373P, S375F, T376A, D405N, R408S, K417N, N440K, S477N, T478K, E484A, Q493R, Q498R, N501Y, Y505H, D614G, H655Y, N679K, P681H, N764K, D796Y, Q954H, N969K
-
Entrez GeneS (a.k.a. GU280_gp02, spike glycoprotein)
- Promoter chicken β-actin promoter, CMV enhancer
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site EcoRI (not destroyed)
- 3′ cloning site NheI (not destroyed)
- 5′ sequencing primer CTCTAGAGCCTCTGCTAACCATGTTC (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Please visit https://www.medrxiv.org/content/10.1101/2022.04.18.22273967v1 for medRxiv preprint.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pCAGGS SARS-CoV-2 BA.2 Spike was a gift from Marceline Côté (Addgene plasmid # 185604 ; http://n2t.net/addgene:185604 ; RRID:Addgene_185604) -
For your References section:
A boost with SARS-CoV-2 BNT162b2 mRNA vaccine elicits strong humoral responses independently of the interval between the first two doses. Tauzin A, Gong SY, Chatterjee D, Ding S, Painter MM, Goel RR, Beaudoin-Bussieres G, Marchitto L, Boutin M, Laumaea A, Okeny J, Gendron-Lepage G, Bourassa C, Medjahed H, Goyette G, Williams JC, Bo Y, Gokool L, Morrisseau C, Arlotto P, Bazin R, Fafard J, Tremblay C, Kaufmann DE, De Serres G, Richard J, Cote M, Duerr R, Martel-Laferriere V, Greenplate AR, Wherry EJ, Finzi A. Cell Rep. 2022 Oct 25;41(4):111554. doi: 10.1016/j.celrep.2022.111554. Epub 2022 Oct 5. 10.1016/j.celrep.2022.111554 PubMed 36244343