Skip to main content

pCAGGS SARS-CoV-2 BA.2.12.1 Spike
(Plasmid #186032)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 186032 Standard format: Plasmid sent in bacteria as agar stab 1 $89 *

* Log in to view industry pricing.

Backbone

  • Vector backbone
    pCAGGS
  • Backbone size w/o insert (bp) 4716
  • Total vector size (bp) 8529
  • Vector type
    Mammalian Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    SARS-CoV-2 BA.2.12.1 Spike
  • Alt name
    SARS CoV-2 Omicron S
  • Insert Size (bp)
    3812
  • Mutation
    Contains the BA.2 mutations (T19I, LPPA24S, G142D, V213G, G339D, S371F, S373P, S375F, T376A, D405N, R408S, K417N, N440K, S477N, T478K, E484A, Q493R, Q498R, N501Y, Y505H, D614G, H655Y, N679K, P681H, N764K, D796Y, Q954H, N969K) in addition to L452Q and S704L
  • Entrez Gene
    S (a.k.a. GU280_gp02, spike glycoprotein)
  • Promoter chicken β-actin promoter, CMV enhancer

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site EcoRI (not destroyed)
  • 3′ cloning site NheI (not destroyed)
  • 5′ sequencing primer CTCTAGAGCCTCTGCTAACCATGTTC
  • (Common Sequencing Primers)

Terms and Licenses

Trademarks:

  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pCAGGS SARS-CoV-2 BA.2.12.1 Spike was a gift from Marceline Côté (Addgene plasmid # 186032 ; http://n2t.net/addgene:186032 ; RRID:Addgene_186032)
  • For your References section:

    Temperature Influences the Interaction between SARS-CoV-2 Spike from Omicron Subvariants and Human ACE2. Gong SY, Ding S, Benlarbi M, Chen Y, Vezina D, Marchitto L, Beaudoin-Bussieres G, Goyette G, Bourassa C, Bo Y, Medjahed H, Levade I, Pazgier M, Cote M, Richard J, Prevost J, Finzi A. Viruses. 2022 Sep 30;14(10):2178. doi: 10.3390/v14102178. 10.3390/v14102178 PubMed 36298733