IST1-GFP
(Plasmid
#186298)
-
PurposeExpresses human IST1 C-terminally fused to GFP
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 186298 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepEGFP-N1
-
Backbone manufacturerClontech
- Total vector size (bp) 5604
-
Modifications to backbonenone
-
Vector typeMammalian Expression
Growth in Bacteria
-
Bacterial Resistance(s)Kanamycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameIST1 homolog
-
Alt nameCHMP8m IST1, hIST1, PM28
-
SpeciesH. sapiens (human)
-
MutationGFP
-
Entrez GeneIST1 (a.k.a. CHMP8, OLC1)
- Promoter CMV
-
Tag
/ Fusion Protein
- GFP (C terminal on insert)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site XhoI (not destroyed)
- 3′ cloning site BamHI (not destroyed)
- 5′ sequencing primer TAACAACTCCGCCCCATT
- 3′ sequencing primer GTCCAGCTCGACCAGGATGGG
- (Common Sequencing Primers)
Resource Information
-
A portion of this plasmid was derived from a plasmid made bySynthetic gene
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
IST1-GFP was a gift from Geert van den Bogaart (Addgene plasmid # 186298 ; http://n2t.net/addgene:186298 ; RRID:Addgene_186298) -
For your References section:
Giant worm-shaped ESCRT scaffolds surround actin-independent integrin clusters. Stempels FC, Jiang M, Warner HM, Moser ML, Janssens MH, Maassen S, Nelen IH, de Boer R, Jiemy WF, Knight D, Selley J, O'Cualain R, Baranov MV, Burgers TCQ, Sansevrino R, Milovanovic D, Heeringa P, Jones MC, Vlijm R, Ter Beest M, van den Bogaart G. J Cell Biol. 2023 Jul 3;222(7):e202205130. doi: 10.1083/jcb.202205130. Epub 2023 May 18. 10.1083/jcb.202205130 PubMed 37200023