Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected] Learn more

pHH21-BNA-Luc
(Plasmid #187924)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 187924 Standard format: Plasmid sent in bacteria as agar stab 1 $85

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    pHH21
  • Backbone size w/o insert (bp) 2828
  • Total vector size (bp) 4637
  • Vector type
    Mammalian Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Growth instructions
    Streak an ampicillin agar plate from the frozen glycerol stock. Grow bacterial culture from a single colony grown on the plate.
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    Reporter RNA (RNA encoding firefly luciferase under the viral promoter of segment 6 of Influenza B/Brisbane/60/2008 virus)
  • Alt name
    B-NA-Luc
  • Insert Size (bp)
    1809
  • Promoter RNA polymease I Promoter

Cloning Information

  • Cloning method Unknown
  • 5′ sequencing primer AAAACGCTGGGCGTTAATCAAAGAGGCG
  • 3′ sequencing primer GGGGGACACTTTCGGACATCTGGTC
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pHH21-BNA-Luc was a gift from Arindam Mondal (Addgene plasmid # 187924 ; http://n2t.net/addgene:187924 ; RRID:Addgene_187924)
  • For your References section:

    A Comprehensive Roadmap Towards the Generation of an Influenza B Reporter Assay Using a Single DNA Polymerase-Based Cloning of the Reporter RNA Construct. Kedia N, Banerjee S, Mondal A. Front Microbiol. 2022 May 25;13:868367. doi: 10.3389/fmicb.2022.868367. eCollection 2022. 10.3389/fmicb.2022.868367 PubMed 35694292