Skip to main content

pHH21-BNA-Luc
(Plasmid #187924)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 187924 Standard format: Plasmid sent in bacteria as agar stab 1 $94
DNA 187924-D50 50 μg of DNA in Tris buffer $495
DNA 187924-D100 100 μg of DNA in Tris buffer $585

Backbone

  • Vector backbone
    pHH21
  • Backbone size w/o insert (bp) 2828
  • Total vector size (bp) 4637
  • Vector type
    Mammalian Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Growth instructions
    Streak an ampicillin agar plate from the frozen glycerol stock. Grow bacterial culture from a single colony grown on the plate.
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    Reporter RNA (RNA encoding firefly luciferase under the viral promoter of segment 6 of Influenza B/Brisbane/60/2008 virus)
  • Alt name
    B-NA-Luc
  • Insert Size (bp)
    1809
  • Promoter RNA polymease I Promoter

Cloning Information

  • Cloning method Unknown
  • 5′ sequencing primer AAAACGCTGGGCGTTAATCAAAGAGGCG
  • 3′ sequencing primer GGGGGACACTTTCGGACATCTGGTC
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

Trademarks:

  • Zeocin® is an InvivoGen trademark.

Purpose

Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.

Delivery

  • Amount 50 μg
  • Concentration 1 μg/μL
  • Pricing $495 USD
  • Storage 4 ℃ (short-term) or -20 ℃ (long-term)

Terms and Licenses

Quality Control

Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.

Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.

Purpose

Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.

Delivery

  • Amount 100 μg
  • Concentration 1 μg/μL
  • Pricing $585 USD
  • Storage 4 ℃ (short-term) or -20 ℃ (long-term)

Terms and Licenses

Quality Control

Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.

Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pHH21-BNA-Luc was a gift from Arindam Mondal (Addgene plasmid # 187924 ; http://n2t.net/addgene:187924 ; RRID:Addgene_187924)
  • For your References section:

    A Comprehensive Roadmap Towards the Generation of an Influenza B Reporter Assay Using a Single DNA Polymerase-Based Cloning of the Reporter RNA Construct. Kedia N, Banerjee S, Mondal A. Front Microbiol. 2022 May 25;13:868367. doi: 10.3389/fmicb.2022.868367. eCollection 2022. 10.3389/fmicb.2022.868367 PubMed 35694292