-
Purpose3rd gen lentiviral vector for knocking down beta-catenin gene expression
-
Depositing Lab
-
Publication
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 18803 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 |
Backbone
-
Vector backbonepLKO.1 puro
-
Backbone manufacturerAvailable at Addgene (#8453)
- Backbone size w/o insert (bp) 7000
-
Vector typeMammalian Expression, Lentiviral, RNAi
-
Selectable markersPuromycin
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)Stbl3
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameb-catenin shRNA
-
Alt namebeta-catenin
-
Alt nameCTNNB1
-
gRNA/shRNA sequenceGCTTGGAATGAGACTGCTGAT
-
SpeciesH. sapiens (human)
-
Entrez GeneCTNNB1 (a.k.a. CTNNB, EVR7, MRD19, NEDSDV, armadillo)
- Promoter U6
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site AgeI (destroyed during cloning)
- 3′ cloning site EcoRI (not destroyed)
- 5′ sequencing primer LKO.1 5' (Common Sequencing Primers)
Resource Information
-
Reference
-
Articles Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
siRNA directed against beta-catenin: 5'-GCTTGGAATGAGACTGCTGAT-3'. Sequence from the website of the RNAi consortium at the Broad institute.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pLKO.1 puro shRNA beta-catenin was a gift from Bob Weinberg (Addgene plasmid # 18803 ; http://n2t.net/addgene:18803 ; RRID:Addgene_18803) -
For your References section:
Loss of E-cadherin promotes metastasis via multiple downstream transcriptional pathways. Onder TT, Gupta PB, Mani SA, Yang J, Lander ES, Weinberg RA. Cancer Res. 2008 May 15. 68(10):3645-54. 10.1158/0008-5472.CAN-07-2938 PubMed 18483246