Skip to main content

pAAV-hSyn-hM3D(Gq)::RAM-d2tTA
(Plasmid #189627)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 189627 Standard format: Plasmid sent in bacteria as agar stab 1 $89

This service is available to academics and nonprofits only.

Please log in to submit a packaging request.
  • Serotype
    Select serotype for details
  • Pricing
    Select serotype and quantity
  • How this works
    • Place a request for a quantity of 2 (0.2 mL), 10 (1 mL), 25 (2.5 mL), or 50 (5 mL). Our all-inclusive pricing includes DNA production and QC.
    • Addgene will quickly confirm that we can produce a high-quality prep for you.
    • Track your request and place an order from within your account. Payment information must be added before we can begin processing your order.
    • Receive your prep in 6–9 weeks after the MTA is approved by your organization.
    • Learn more about our Packaged on Request Service.

Backbone

  • Vector backbone
    pAAV
  • Backbone size w/o insert (bp) 3659
  • Total vector size (bp) 7292
  • Vector type
    Mammalian Expression, AAV

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    Unknown

Gene/Insert 1

  • Gene/Insert name
    hM3D(Gq)
  • Alt name
    hM3Dq
  • Species
    H. sapiens (human)
  • Promoter hSyn
  • Tag / Fusion Protein
    • HA (N terminal on insert)

Cloning Information for Gene/Insert 1

Gene/Insert 2

  • Gene/Insert name
    d2tTA
  • Alt name
    tetracycline-controlled transactivator
  • Promoter pRAM

Cloning Information for Gene/Insert 2

  • Cloning method Gibson Cloning
  • 5′ sequencing primer ggctgttgggcactgacaat
  • 3′ sequencing primer taatacgactcactataggg
  • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.

Depositor Comments

hSyn-hM3D(Gq) is derived from pAAV-hSyn-hM3D(Gq)-mCherry (Addgene #50474).
RAM-d2tTA is derived from pAAV-RAM-d2TTA::TRE-MCS-WPRE-pA (Addgene #63931).

Please visit https://www.biorxiv.org/content/10.1101/2022.07.17.500352v1 for BioRxiv preprint

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pAAV-hSyn-hM3D(Gq)::RAM-d2tTA was a gift from Jerzy Szablowski (Addgene plasmid # 189627 ; http://n2t.net/addgene:189627 ; RRID:Addgene_189627)
  • For your References section:

    Engineered serum markers for non-invasive monitoring of gene expression in the brain. Lee S, Nouraein S, Kwon JJ, Huang Z, Wojick JA, Xia B, Corder G, Szablowski JO. Nat Biotechnol. 2024 Jan 10. doi: 10.1038/s41587-023-02087-x. 10.1038/s41587-023-02087-x PubMed 38200117