Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

pD2529-CAG-b3
(Plasmid #189797)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 189797 Standard format: Plasmid sent in bacteria as agar stab 1 $85

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    pD2529CAG
  • Backbone manufacturer
    Atum
  • Vector type
    Mammalian Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Kanamycin, 50 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    integrin b3
  • Alt name
    beta 3 BDPLT16, BDPLT2, BDPLT24, CD61, GP3A, GPIIIa, GT, GT2
  • Species
    H. sapiens (human)
  • Entrez Gene
    ITGB3 (a.k.a. BDPLT16, BDPLT2, BDPLT24, CD61, GP3A, GPIIIa, GT, GT2)
  • Tag / Fusion Protein
    • -P2A-mCherry (C terminal on insert)

Cloning Information

  • Cloning method Gibson Cloning
  • 5′ sequencing primer TTTCCTACAGCTCCTGGGCAAC
  • 3′ sequencing primer CATGTGCACCTTGAAGCG
  • (Common Sequencing Primers)

Terms and Licenses

Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pD2529-CAG-b3 was a gift from Timothy Springer (Addgene plasmid # 189797 ; http://n2t.net/addgene:189797 ; RRID:Addgene_189797)
  • For your References section:

    A general chemical principle for creating closure-stabilizing integrin inhibitors. Lin FY, Li J, Xie Y, Zhu J, Huong Nguyen TT, Zhang Y, Zhu J, Springer TA. Cell. 2022 Sep 15;185(19):3533-3550.e27. doi: 10.1016/j.cell.2022.08.008. 10.1016/j.cell.2022.08.008 PubMed 36113427