Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

pAc-sgRNA-Cas9.scr_2
(Plasmid #190704)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 190704 Standard format: Plasmid sent in bacteria as agar stab 1 $85

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    pAc-sgRNA-Cas9
  • Backbone manufacturer
    Ji-Long Liu
  • Backbone size w/o insert (bp) 10615
  • Total vector size (bp) 10635
  • Vector type
    Insect Expression, CRISPR
  • Selectable markers
    Puromycin

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    Scrambled sgRNA 2
  • gRNA/shRNA sequence
    CAAGCCTCAGGTAGATACAG
  • Species
    D. melanogaster (fly)
  • Promoter Drosophila U6

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site SapI (destroyed during cloning)
  • 3′ cloning site SapI (destroyed during cloning)
  • 5′ sequencing primer GTTCGACTTGCAGCCTGAAATACG
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pAc-sgRNA-Cas9.scr_2 was a gift from David Bartel (Addgene plasmid # 190704 ; http://n2t.net/addgene:190704 ; RRID:Addgene_190704)
  • For your References section:

    Endogenous transcripts direct microRNA degradation in Drosophila, and this targeted degradation is required for proper embryonic development. Kingston ER, Blodgett LW, Bartel DP. Mol Cell. 2022 Sep 15. pii: S1097-2765(22)00849-8. doi: 10.1016/j.molcel.2022.08.029. 10.1016/j.molcel.2022.08.029 PubMed 36150386