ATOH1_pUC18
(Plasmid
#191250)
-
PurposeEncodes the sequence for the ATOH1 gene (human)
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 191250 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepUC18
-
Backbone manufacturerPlasmid #50004
-
Vector typeBacterial Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameATOH1
-
SpeciesH. sapiens (human)
-
Insert Size (bp)3631
-
Entrez GeneATOH1 (a.k.a. ATH1, DFNA89, HATH1, MATH-1, bHLHa14)
- Promoter lac promoter
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer GCAGAGCCCAAACATTCACACA
- 3′ sequencing primer GCGGAGTTTCCTAAAAGACGCC
- (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
-
Article Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
ATOH1_pUC18 was a gift from Chen Davidovich (Addgene plasmid # 191250 ; http://n2t.net/addgene:191250 ; RRID:Addgene_191250) -
For your References section:
PALI1 facilitates DNA and nucleosome binding by PRC2 and triggers an allosteric activation of catalysis. Zhang Q, Agius SC, Flanigan SF, Uckelmann M, Levina V, Owen BM, Davidovich C. Nat Commun. 2021 Jul 28;12(1):4592. doi: 10.1038/s41467-021-24866-3. 10.1038/s41467-021-24866-3 PubMed 34321472